GT-Scan2
1: 12776100 - 12776420 ...
Select a target for additional information!
Location Strand Candidate Target Sequence Predicted Activity 0 1 2 3 Experimental Results 12,776,266 + CACTGTGCACATCCCTGCAGCGG High 0 0 0 0
...
12,776,257 - GGATGTGCACAGTGAAAAAATGG High 0 0 0 0
...
12,776,150 + CCTCTCAGCCCGCTCTGAGCTGG High 0 0 0 0
...
12,776,150 - CCAGCTCAGAGCGGGCTGAGAGG High 0 0 0 0
...
12,776,159 - ATGCTGCTTCCAGCTCAGAGCGG High 0 0 0 0
...
Items per page:
1 - 5 of 43