TUSCAN
1: 12776100 - 12776420 ...
Strand Candidate Target Sequence
12,776,203 - AGAACACTCAGGCTGCTGCGAGG 4.29722918927 12,776,150 - CCAGCTCAGAGCGGGCTGAGAGG 3.84322371882 12,776,223 + TCTCACTAGGGGTCACTCTGTGG 3.83559436091 12,776,150 + CCTCTCAGCCCGCTCTGAGCTGG 3.04038856814 12,776,134 - TGAGAGGAAGCTGTGCGCAGTGG 2.7031122669 12,776,314 - GCAGCTGGAAGATGCAATGGAGG 2.68396783759 12,776,159 - ATGCTGCTTCCAGCTCAGAGCGG 2.50238959746 12,776,376 + CAGCTGACCATTAAGGAAGGCGG 2.27481805589 12,776,170 + TGGAAGCAGCATGTGGGACCTGG 2.27056790114 12,776,163 + TCTGAGCTGGAAGCAGCATGTGG 2.23089076528
Items per page:
1 - 10 of 43